primary ectocervical epithelial cells (crec) Search Results


97
ATCC amphotropic packaging cell line gp envam12
Amphotropic Packaging Cell Line Gp Envam12, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+ectocervical+epithelial+cells+(crec)/TIBx%3B+Epithelial+liver%3B+Mouse/pmc01488939-66-3-8
Average 97 stars, based on 1 article reviews
amphotropic packaging cell line gp envam12 - by Bioz Stars, 2026-10
97/100 stars
  Buy from Supplier

86
Jackson Laboratory epithelial cell targeted cdx2 cre
Epithelial Cell Targeted Cdx2 Cre, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+ectocervical+epithelial+cells+(crec)/cdx2+cre/pm42248857-323-21-24
Average 86 stars, based on 1 article reviews
epithelial cell targeted cdx2 cre - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Jackson Laboratory podocyte specific cre recombinase podo cre mice
Podocyte Specific Cre Recombinase Podo Cre Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+ectocervical+epithelial+cells+(crec)/cre+recombinase/pmc08759037-9-0-10
Average 86 stars, based on 1 article reviews
podocyte specific cre recombinase podo cre mice - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology e cadherin
(A) Oncomine data of whole tumor tissue vs. normal pancreas tissue examining OSM and OSMR mRNA levels in PDAC and normal pancreas (60). (B) Expression of a STAT3 gene expression signature (generated by filtering Pancreatic Cancer vs. Normal analysis; then applying filter “genes differentially expressed in melanoma cells in response to STAT3 expression”) in PDAC and normal pancreas. (C–E) A panel of PDAC cells lines were treated with recombinant OSM for one week and analyzed for morphological changes using bright-field microscopy (D; images shown at 200X). STAT3 phosphorylation (Tyr 705), total STAT3, and Actin were assessed using Western blot analysis (D), and <t>E-Cadherin</t> (CDH1) and ZEB1 were assessed using qRT-PCR (E).
E Cadherin, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+ectocervical+epithelial+cells+(crec)/E-cadherin+Antibody/pmc05380554-107-8-10
Average 96 stars, based on 1 article reviews
e cadherin - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

93
Proteintech anti α sma e cadherin
(A) Oncomine data of whole tumor tissue vs. normal pancreas tissue examining OSM and OSMR mRNA levels in PDAC and normal pancreas (60). (B) Expression of a STAT3 gene expression signature (generated by filtering Pancreatic Cancer vs. Normal analysis; then applying filter “genes differentially expressed in melanoma cells in response to STAT3 expression”) in PDAC and normal pancreas. (C–E) A panel of PDAC cells lines were treated with recombinant OSM for one week and analyzed for morphological changes using bright-field microscopy (D; images shown at 200X). STAT3 phosphorylation (Tyr 705), total STAT3, and Actin were assessed using Western blot analysis (D), and <t>E-Cadherin</t> (CDH1) and ZEB1 were assessed using qRT-PCR (E).
Anti α Sma E Cadherin, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+ectocervical+epithelial+cells+(crec)/CRTC2%2CTORC2+Antibody/pm37884902-93-8-12
Average 93 stars, based on 1 article reviews
anti α sma e cadherin - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

94
Cyagen Biosciences tubule epithelial cell specific ggt1 cre recombinase
(A) Oncomine data of whole tumor tissue vs. normal pancreas tissue examining OSM and OSMR mRNA levels in PDAC and normal pancreas (60). (B) Expression of a STAT3 gene expression signature (generated by filtering Pancreatic Cancer vs. Normal analysis; then applying filter “genes differentially expressed in melanoma cells in response to STAT3 expression”) in PDAC and normal pancreas. (C–E) A panel of PDAC cells lines were treated with recombinant OSM for one week and analyzed for morphological changes using bright-field microscopy (D; images shown at 200X). STAT3 phosphorylation (Tyr 705), total STAT3, and Actin were assessed using Western blot analysis (D), and <t>E-Cadherin</t> (CDH1) and ZEB1 were assessed using qRT-PCR (E).
Tubule Epithelial Cell Specific Ggt1 Cre Recombinase, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+ectocervical+epithelial+cells+(crec)/Ggt1/pm41820550-60-22-27
Average 94 stars, based on 1 article reviews
tubule epithelial cell specific ggt1 cre recombinase - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

90
StemCells Inc mammary epithelium enrichment kit
(A) Oncomine data of whole tumor tissue vs. normal pancreas tissue examining OSM and OSMR mRNA levels in PDAC and normal pancreas (60). (B) Expression of a STAT3 gene expression signature (generated by filtering Pancreatic Cancer vs. Normal analysis; then applying filter “genes differentially expressed in melanoma cells in response to STAT3 expression”) in PDAC and normal pancreas. (C–E) A panel of PDAC cells lines were treated with recombinant OSM for one week and analyzed for morphological changes using bright-field microscopy (D; images shown at 200X). STAT3 phosphorylation (Tyr 705), total STAT3, and Actin were assessed using Western blot analysis (D), and <t>E-Cadherin</t> (CDH1) and ZEB1 were assessed using qRT-PCR (E).
Mammary Epithelium Enrichment Kit, supplied by StemCells Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+ectocervical+epithelial+cells+(crec)/mammary+epithelium+enrichment+kit/pm28041896-281-14-23
Average 90 stars, based on 1 article reviews
mammary epithelium enrichment kit - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

92
ATCC phoh cyb 2320 phoh family protein thermosynechococcus elongatus bp
(A) Oncomine data of whole tumor tissue vs. normal pancreas tissue examining OSM and OSMR mRNA levels in PDAC and normal pancreas (60). (B) Expression of a STAT3 gene expression signature (generated by filtering Pancreatic Cancer vs. Normal analysis; then applying filter “genes differentially expressed in melanoma cells in response to STAT3 expression”) in PDAC and normal pancreas. (C–E) A panel of PDAC cells lines were treated with recombinant OSM for one week and analyzed for morphological changes using bright-field microscopy (D; images shown at 200X). STAT3 phosphorylation (Tyr 705), total STAT3, and Actin were assessed using Western blot analysis (D), and <t>E-Cadherin</t> (CDH1) and ZEB1 were assessed using qRT-PCR (E).
Phoh Cyb 2320 Phoh Family Protein Thermosynechococcus Elongatus Bp, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+ectocervical+epithelial+cells+(crec)/HCC1008/10__1128_slash_jb__01011___08-155-79-113
Average 92 stars, based on 1 article reviews
phoh cyb 2320 phoh family protein thermosynechococcus elongatus bp - by Bioz Stars, 2026-10
92/100 stars
  Buy from Supplier

86
Jackson Laboratory pb cre4 mice
(A) Oncomine data of whole tumor tissue vs. normal pancreas tissue examining OSM and OSMR mRNA levels in PDAC and normal pancreas (60). (B) Expression of a STAT3 gene expression signature (generated by filtering Pancreatic Cancer vs. Normal analysis; then applying filter “genes differentially expressed in melanoma cells in response to STAT3 expression”) in PDAC and normal pancreas. (C–E) A panel of PDAC cells lines were treated with recombinant OSM for one week and analyzed for morphological changes using bright-field microscopy (D; images shown at 200X). STAT3 phosphorylation (Tyr 705), total STAT3, and Actin were assessed using Western blot analysis (D), and <t>E-Cadherin</t> (CDH1) and ZEB1 were assessed using qRT-PCR (E).
Pb Cre4 Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+ectocervical+epithelial+cells+(crec)/cre4+mice+pb+probasin/pmc12515719-75-15-29
Average 86 stars, based on 1 article reviews
pb cre4 mice - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

99
ATCC cell lines iat2 type 2 pneumocytes crem
Figure 1. Phospho/Proteomic Profiling of Human iAT2s after SARS-CoV-2 Infection (A) (Top) Schematic of 3D alveolospheres and <t>iAT2</t> ALI cultures. Apical media was removed for 7 days before infection with SARS-CoV-2; DE, definitive endoderm; AFE, anterior foregut endoderm. Representative confocal IFA images (103) of iAT2s expressing tdTomato from endogenous SFTPC locus. (Bottom) iAT2 ALI cultures were infected with SARS-CoV-2 (MOI = 5) for indicated times with parallel mock-treated controls. Representative staining (203) of DNA (Hoechst, blue) and viral N (green) indicating infection. (B) Total protein from replicate SARS-CoV-2-infected and mock-treated iAT2s was analyzed by quantitative LC-MS/MS. (C) Replicate measurements were normalized and filtered (<1% FDR), resulting in high reproducibility (r = PCC). Venn diagram shows number of identified cellular/ viral proteins/phosphosites subject to downstream analysis.
Cell Lines Iat2 Type 2 Pneumocytes Crem, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+ectocervical+epithelial+cells+(crec)/Vero/pm33259812-482-130-142
Average 99 stars, based on 1 article reviews
cell lines iat2 type 2 pneumocytes crem - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier

90
GemPharmatech Co Ltd podocyte-specific otud5 knockout mice (nphs1-cre otud5fl/fl mice; otud5cko
a A volcano plot analysis illustrating the differential expression of DUBs induced by HG/PA in podocytes. ( n = 3 samples for each Ctrl group and HG/PA group; P values were determined by Wald test from DESeq2 software with Benjamini-Hochberg’s correction). b A table shows DUBs with significant differences in MPC5 cells treated with HG/PA. c The mRNA level of <t>Otud5</t> in HG/PA-induced MPC5 cell lines. ( n = 3 independent experiments; P values were determined by two-tailed unpaired t -test and data are presented as mean ± SD). d Representative western blot of OTUD5 expression in MPC5 cell lines after stimulation with HG/PA for different durations. ( n = 3 independent experiments). e Representative immunofluorescence (IF) images of OTUD5 expression in human renal tissue from normal subjects ( n = 3 samples) and patients with DKD ( n = 3 samples). Scale bar, 50 μm. Representative western blot of OTUD5 expression in renal cortex of T2DM ( f ) mice and T1DM mice ( g ). ( n = 6 samples). Representative western blot of OTUD5 expression in renal cortex of NOD ( h ) mice and db/db mice ( i ). ( n = 6 samples). j , k Representative western blot of OTUD5 expression in primary podocytes of T2DM ( j ) and T1DM ( k ) mice. ( n = 6 samples). l MPC5 cells transfected with Flag-OTUD5 were stimulated with HG/PA for 8 h. Real-time qPCR showed the mRNA levels of Il6 and Tnfα . ( n = 3 independent experiments; P values were determined by one-way ANOVA with Bonferroni’s correction and data are presented as mean ± SD). Representative western blot of Cleaved Caspase3 ( m ) and Nephrin ( n ) expression in OTUD5-overexpression podocytes stimulated by HG/PA for 24 h. ( n = 3 independent experiments).
Podocyte Specific Otud5 Knockout Mice (Nphs1 Cre Otud5fl/Fl Mice; Otud5cko, supplied by GemPharmatech Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+ectocervical+epithelial+cells+(crec)/podocyte+specific+otud5+knockout+mice++nphs1+cre+otud5fl+fl+mice++otud5cko/pmc11211476-236-0-11
Average 90 stars, based on 1 article reviews
podocyte-specific otud5 knockout mice (nphs1-cre otud5fl/fl mice; otud5cko - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

94
Cell Signaling Technology Inc e cadherin antibody
a A volcano plot analysis illustrating the differential expression of DUBs induced by HG/PA in podocytes. ( n = 3 samples for each Ctrl group and HG/PA group; P values were determined by Wald test from DESeq2 software with Benjamini-Hochberg’s correction). b A table shows DUBs with significant differences in MPC5 cells treated with HG/PA. c The mRNA level of <t>Otud5</t> in HG/PA-induced MPC5 cell lines. ( n = 3 independent experiments; P values were determined by two-tailed unpaired t -test and data are presented as mean ± SD). d Representative western blot of OTUD5 expression in MPC5 cell lines after stimulation with HG/PA for different durations. ( n = 3 independent experiments). e Representative immunofluorescence (IF) images of OTUD5 expression in human renal tissue from normal subjects ( n = 3 samples) and patients with DKD ( n = 3 samples). Scale bar, 50 μm. Representative western blot of OTUD5 expression in renal cortex of T2DM ( f ) mice and T1DM mice ( g ). ( n = 6 samples). Representative western blot of OTUD5 expression in renal cortex of NOD ( h ) mice and db/db mice ( i ). ( n = 6 samples). j , k Representative western blot of OTUD5 expression in primary podocytes of T2DM ( j ) and T1DM ( k ) mice. ( n = 6 samples). l MPC5 cells transfected with Flag-OTUD5 were stimulated with HG/PA for 8 h. Real-time qPCR showed the mRNA levels of Il6 and Tnfα . ( n = 3 independent experiments; P values were determined by one-way ANOVA with Bonferroni’s correction and data are presented as mean ± SD). Representative western blot of Cleaved Caspase3 ( m ) and Nephrin ( n ) expression in OTUD5-overexpression podocytes stimulated by HG/PA for 24 h. ( n = 3 independent experiments).
E Cadherin Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+ectocervical+epithelial+cells+(crec)/Phospho-CREB+(Ser133)+Rabbit+mAb/pmc04016150-215-0-13
Average 94 stars, based on 1 article reviews
e cadherin antibody - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

Image Search Results


(A) Oncomine data of whole tumor tissue vs. normal pancreas tissue examining OSM and OSMR mRNA levels in PDAC and normal pancreas (60). (B) Expression of a STAT3 gene expression signature (generated by filtering Pancreatic Cancer vs. Normal analysis; then applying filter “genes differentially expressed in melanoma cells in response to STAT3 expression”) in PDAC and normal pancreas. (C–E) A panel of PDAC cells lines were treated with recombinant OSM for one week and analyzed for morphological changes using bright-field microscopy (D; images shown at 200X). STAT3 phosphorylation (Tyr 705), total STAT3, and Actin were assessed using Western blot analysis (D), and E-Cadherin (CDH1) and ZEB1 were assessed using qRT-PCR (E).

Journal: Molecular cancer research : MCR

Article Title: Potent EMT and CSC Phenotypes are Induced by Oncostatin-M in Pancreatic Cancer

doi: 10.1158/1541-7786.MCR-16-0337

Figure Lengend Snippet: (A) Oncomine data of whole tumor tissue vs. normal pancreas tissue examining OSM and OSMR mRNA levels in PDAC and normal pancreas (60). (B) Expression of a STAT3 gene expression signature (generated by filtering Pancreatic Cancer vs. Normal analysis; then applying filter “genes differentially expressed in melanoma cells in response to STAT3 expression”) in PDAC and normal pancreas. (C–E) A panel of PDAC cells lines were treated with recombinant OSM for one week and analyzed for morphological changes using bright-field microscopy (D; images shown at 200X). STAT3 phosphorylation (Tyr 705), total STAT3, and Actin were assessed using Western blot analysis (D), and E-Cadherin (CDH1) and ZEB1 were assessed using qRT-PCR (E).

Article Snippet: Primary antibodies used were Actin (#MS-1295-P; Thermo Scientific), E-Cadherin (#sc-27191; Santa Cruz, #3195; Cell Signaling), Snail (#3879; Cell Signaling), phosphorylated STAT3 Y705 (#9145; Cell Signaling), STAT3 (#9139; Cell Signaling), and ZEB1 (#3396; Cell Signaling).

Techniques: Expressing, Generated, Recombinant, Microscopy, Western Blot, Quantitative RT-PCR

Elevated OSM within the pancreatic tumor microenvironment induces STAT3 activation (Y705 phosphorylation), leading to transcriptional activation of ZEB1. As ZEB1 accumulates, E-Cadherin and CD24 surface expression are repressed, while Snail and CD44 surface expression are increased. The resulting EMT and acquisition of CSC properties decrease gemcitabine sensitivity, and increase tumor initiating capacity and metastasis. (A–C) Points where the aggressive phenotypes engaged by OSM can be inhibited (including OSM neutralizing or OSMR blocking antibodies, chemical inhibition of activated OSMR/JAK, or ZEB1 silencing).

Journal: Molecular cancer research : MCR

Article Title: Potent EMT and CSC Phenotypes are Induced by Oncostatin-M in Pancreatic Cancer

doi: 10.1158/1541-7786.MCR-16-0337

Figure Lengend Snippet: Elevated OSM within the pancreatic tumor microenvironment induces STAT3 activation (Y705 phosphorylation), leading to transcriptional activation of ZEB1. As ZEB1 accumulates, E-Cadherin and CD24 surface expression are repressed, while Snail and CD44 surface expression are increased. The resulting EMT and acquisition of CSC properties decrease gemcitabine sensitivity, and increase tumor initiating capacity and metastasis. (A–C) Points where the aggressive phenotypes engaged by OSM can be inhibited (including OSM neutralizing or OSMR blocking antibodies, chemical inhibition of activated OSMR/JAK, or ZEB1 silencing).

Article Snippet: Primary antibodies used were Actin (#MS-1295-P; Thermo Scientific), E-Cadherin (#sc-27191; Santa Cruz, #3195; Cell Signaling), Snail (#3879; Cell Signaling), phosphorylated STAT3 Y705 (#9145; Cell Signaling), STAT3 (#9139; Cell Signaling), and ZEB1 (#3396; Cell Signaling).

Techniques: Activation Assay, Expressing, Blocking Assay, Inhibition

Figure 1. Phospho/Proteomic Profiling of Human iAT2s after SARS-CoV-2 Infection (A) (Top) Schematic of 3D alveolospheres and iAT2 ALI cultures. Apical media was removed for 7 days before infection with SARS-CoV-2; DE, definitive endoderm; AFE, anterior foregut endoderm. Representative confocal IFA images (103) of iAT2s expressing tdTomato from endogenous SFTPC locus. (Bottom) iAT2 ALI cultures were infected with SARS-CoV-2 (MOI = 5) for indicated times with parallel mock-treated controls. Representative staining (203) of DNA (Hoechst, blue) and viral N (green) indicating infection. (B) Total protein from replicate SARS-CoV-2-infected and mock-treated iAT2s was analyzed by quantitative LC-MS/MS. (C) Replicate measurements were normalized and filtered (<1% FDR), resulting in high reproducibility (r = PCC). Venn diagram shows number of identified cellular/ viral proteins/phosphosites subject to downstream analysis.

Journal: Molecular cell

Article Title: Actionable Cytopathogenic Host Responses of Human Alveolar Type 2 Cells to SARS-CoV-2.

doi: 10.1016/j.molcel.2020.11.028

Figure Lengend Snippet: Figure 1. Phospho/Proteomic Profiling of Human iAT2s after SARS-CoV-2 Infection (A) (Top) Schematic of 3D alveolospheres and iAT2 ALI cultures. Apical media was removed for 7 days before infection with SARS-CoV-2; DE, definitive endoderm; AFE, anterior foregut endoderm. Representative confocal IFA images (103) of iAT2s expressing tdTomato from endogenous SFTPC locus. (Bottom) iAT2 ALI cultures were infected with SARS-CoV-2 (MOI = 5) for indicated times with parallel mock-treated controls. Representative staining (203) of DNA (Hoechst, blue) and viral N (green) indicating infection. (B) Total protein from replicate SARS-CoV-2-infected and mock-treated iAT2s was analyzed by quantitative LC-MS/MS. (C) Replicate measurements were normalized and filtered (<1% FDR), resulting in high reproducibility (r = PCC). Venn diagram shows number of identified cellular/ viral proteins/phosphosites subject to downstream analysis.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER danusertib Selleck S1107 dorsomorphin Selleck S7840 ellagic-acid Selleck S1327 emricasan Selleck S7775 FRAX486 Selleck S7807 KN-93 Selleck S7423 levofloxacin Selleck S1940 losmapimod Selleck S7215 NVP-BEZ235 Selleck S1009 PCI-27483 Cayman 21334 PFI-3 Selleck S7315 RK-33 Selleck S8246 Roflumilast Selleck S2131 SB-415286 Selleck S2729 sirolimus Selleck S1039 SRPIN340 Selleck S7270 teriflunomide Selleck S4169 TG-003 Selleck S7320 TIC10 Selleck S7963 tideglusib Selleck S2823 tubercidin Selleck S8095 vandetanib Selleck S1046 VE-822 Selleck S7102 volasertib Selleck S2235 Critical Commercial Assays Pierce Quantitative Colorimetric Peptide Assay Thermo 23275 Deposited Data Raw MS/MS data and search results This Paper ProteomeXchange - PRIDE: PXD020183 Human Proteome, all canonical reviewed sequences Swiss-Prot, uniprot.org Downloaded 2020-02-10 SARS-CoV-2 Proteome, all Swiss-Prot and TrEMBL sequences Uniprot.org Downloaded 2020-05-03 Imaging and processed data This Paper https://doi.org/10.17632/vhm7zh5ssp.2 Experimental Models: Cell Lines iAT2 Type 2 Pneumocytes CReM, Boston University SPC2-ST-B2 Vero E6 ATCC CRL-1586 Oligonucleotides CCNL_F_1 IDT TGAACGTAATCAAACCCTGGTTCA CCNL-Int_R_3 IDT CCTCTGCACTTCAGCCCATG CCNL1_R_2 IDT TTGCATCTACCTTGCAGCTAGAGC DOCK4_F_1 IDT TCCTCCTCACTGTCCTCACAAGC DOCK4_int_R_3 IDT AAAGCCTAGGCACGCTGCAC DOCK4_R_2 IDT TCACTCGGCTTCACCTAATGTGA FERMT3_F_1 IDT ATCTACCTGCGGTGCCAGGA FERMT3_R_2 IDT TCCAGCGAAAGTTCAAGGCC RBM5_F_1 IDT TAAGCCGTGGTTTCGCCTTC RBM5_R_2 IDT TGGTGATTCAAGGAAAGCACATTG NPR2_F_1 IDT GGCATGGCCTTTCTCCACAA NPR2_R_2 IDT GAACCCCTTGCCAACCACAG (Continued on next page) ll Resource e2 Molecular Cell 80, 1104–1122.e1–e9, December 17, 2020

Techniques: Infection, Expressing, Staining, Liquid Chromatography with Mass Spectroscopy

Figure 3. Phosphoproteomic Profiling Reveals Dysregulated Pathways (A) Bar-plot of differential phosphosites (1–6 hpi). (B) Domain structure of SARS-CoV-2 N (top) and M (bottom) showing identified phosphosites. (C) Structural models of phospho-CNSKA2 (S197) complexed with viral N (S79). (D) Clustering of phosphosite abundance changes. (E) Enriched pathways and processes. (F) Up- or downregulated kinases (KSEA). (G) IFA of phosphogamma-H2AX (green) and viral N (red) in infected versus mock-treated iAT2 (DAPI counterstain). Greyscale images show exclusively phospho- g-H2AX localization in iAT2s (number foci per nucleus shown at right, p value < 0.05, Wilcoxon rank-sum test).

Journal: Molecular cell

Article Title: Actionable Cytopathogenic Host Responses of Human Alveolar Type 2 Cells to SARS-CoV-2.

doi: 10.1016/j.molcel.2020.11.028

Figure Lengend Snippet: Figure 3. Phosphoproteomic Profiling Reveals Dysregulated Pathways (A) Bar-plot of differential phosphosites (1–6 hpi). (B) Domain structure of SARS-CoV-2 N (top) and M (bottom) showing identified phosphosites. (C) Structural models of phospho-CNSKA2 (S197) complexed with viral N (S79). (D) Clustering of phosphosite abundance changes. (E) Enriched pathways and processes. (F) Up- or downregulated kinases (KSEA). (G) IFA of phosphogamma-H2AX (green) and viral N (red) in infected versus mock-treated iAT2 (DAPI counterstain). Greyscale images show exclusively phospho- g-H2AX localization in iAT2s (number foci per nucleus shown at right, p value < 0.05, Wilcoxon rank-sum test).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER danusertib Selleck S1107 dorsomorphin Selleck S7840 ellagic-acid Selleck S1327 emricasan Selleck S7775 FRAX486 Selleck S7807 KN-93 Selleck S7423 levofloxacin Selleck S1940 losmapimod Selleck S7215 NVP-BEZ235 Selleck S1009 PCI-27483 Cayman 21334 PFI-3 Selleck S7315 RK-33 Selleck S8246 Roflumilast Selleck S2131 SB-415286 Selleck S2729 sirolimus Selleck S1039 SRPIN340 Selleck S7270 teriflunomide Selleck S4169 TG-003 Selleck S7320 TIC10 Selleck S7963 tideglusib Selleck S2823 tubercidin Selleck S8095 vandetanib Selleck S1046 VE-822 Selleck S7102 volasertib Selleck S2235 Critical Commercial Assays Pierce Quantitative Colorimetric Peptide Assay Thermo 23275 Deposited Data Raw MS/MS data and search results This Paper ProteomeXchange - PRIDE: PXD020183 Human Proteome, all canonical reviewed sequences Swiss-Prot, uniprot.org Downloaded 2020-02-10 SARS-CoV-2 Proteome, all Swiss-Prot and TrEMBL sequences Uniprot.org Downloaded 2020-05-03 Imaging and processed data This Paper https://doi.org/10.17632/vhm7zh5ssp.2 Experimental Models: Cell Lines iAT2 Type 2 Pneumocytes CReM, Boston University SPC2-ST-B2 Vero E6 ATCC CRL-1586 Oligonucleotides CCNL_F_1 IDT TGAACGTAATCAAACCCTGGTTCA CCNL-Int_R_3 IDT CCTCTGCACTTCAGCCCATG CCNL1_R_2 IDT TTGCATCTACCTTGCAGCTAGAGC DOCK4_F_1 IDT TCCTCCTCACTGTCCTCACAAGC DOCK4_int_R_3 IDT AAAGCCTAGGCACGCTGCAC DOCK4_R_2 IDT TCACTCGGCTTCACCTAATGTGA FERMT3_F_1 IDT ATCTACCTGCGGTGCCAGGA FERMT3_R_2 IDT TCCAGCGAAAGTTCAAGGCC RBM5_F_1 IDT TAAGCCGTGGTTTCGCCTTC RBM5_R_2 IDT TGGTGATTCAAGGAAAGCACATTG NPR2_F_1 IDT GGCATGGCCTTTCTCCACAA NPR2_R_2 IDT GAACCCCTTGCCAACCACAG (Continued on next page) ll Resource e2 Molecular Cell 80, 1104–1122.e1–e9, December 17, 2020

Techniques: Phospho-proteomics, Infection

Figure 4. Validation Analyses (A) Immunoblotting of lysates from mock and SARS-CoV-2-infected iAT2 ALI at 24 hpi. Probes indicated (beta-actin loading control). (B) (Left) Hyperphosphorylation of SRSF proteins 24 hpi. (Right) Position and relative change in phosphosites. (C) 3D model of hyperphosphorylated sites (S199/S197/S204/S211) on SRSF9 in infected iAT2s relative to controls. (D) Schematic of splicing events impacted by infection. (E) Analyses of RNA-seq data (Huang et al., 2020) showing virus-induced splicing alterations. (F) Functional annotations of differential spliced gene products. (G) Ratio of spliced to unspliced transcripts for select mRNAs in mock or infected iAT2s. For CLK1, ratio of splicing with/without exon 4 (E4) inclusion shown. Bars represent mean (±SD) from 3 biological replicates; *p < 0.1; **p < 0.01; ***p < 0.001, t test. (H) EM images of nuclear envelope (white arrows), ER (red; double-points indicate extended ER), ribosomes (yellow), and nucleus (N) in mock and infected iAT2s (scale bar = 500 nm; insets magnified 43). (I) IFA (403) and quantification (±SD) of g-tubulin (594 nm) and viral N (488 nm) in control and infected iAT2s (counterstained with DAPI). Scale bar = 10 mm.

Journal: Molecular cell

Article Title: Actionable Cytopathogenic Host Responses of Human Alveolar Type 2 Cells to SARS-CoV-2.

doi: 10.1016/j.molcel.2020.11.028

Figure Lengend Snippet: Figure 4. Validation Analyses (A) Immunoblotting of lysates from mock and SARS-CoV-2-infected iAT2 ALI at 24 hpi. Probes indicated (beta-actin loading control). (B) (Left) Hyperphosphorylation of SRSF proteins 24 hpi. (Right) Position and relative change in phosphosites. (C) 3D model of hyperphosphorylated sites (S199/S197/S204/S211) on SRSF9 in infected iAT2s relative to controls. (D) Schematic of splicing events impacted by infection. (E) Analyses of RNA-seq data (Huang et al., 2020) showing virus-induced splicing alterations. (F) Functional annotations of differential spliced gene products. (G) Ratio of spliced to unspliced transcripts for select mRNAs in mock or infected iAT2s. For CLK1, ratio of splicing with/without exon 4 (E4) inclusion shown. Bars represent mean (±SD) from 3 biological replicates; *p < 0.1; **p < 0.01; ***p < 0.001, t test. (H) EM images of nuclear envelope (white arrows), ER (red; double-points indicate extended ER), ribosomes (yellow), and nucleus (N) in mock and infected iAT2s (scale bar = 500 nm; insets magnified 43). (I) IFA (403) and quantification (±SD) of g-tubulin (594 nm) and viral N (488 nm) in control and infected iAT2s (counterstained with DAPI). Scale bar = 10 mm.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER danusertib Selleck S1107 dorsomorphin Selleck S7840 ellagic-acid Selleck S1327 emricasan Selleck S7775 FRAX486 Selleck S7807 KN-93 Selleck S7423 levofloxacin Selleck S1940 losmapimod Selleck S7215 NVP-BEZ235 Selleck S1009 PCI-27483 Cayman 21334 PFI-3 Selleck S7315 RK-33 Selleck S8246 Roflumilast Selleck S2131 SB-415286 Selleck S2729 sirolimus Selleck S1039 SRPIN340 Selleck S7270 teriflunomide Selleck S4169 TG-003 Selleck S7320 TIC10 Selleck S7963 tideglusib Selleck S2823 tubercidin Selleck S8095 vandetanib Selleck S1046 VE-822 Selleck S7102 volasertib Selleck S2235 Critical Commercial Assays Pierce Quantitative Colorimetric Peptide Assay Thermo 23275 Deposited Data Raw MS/MS data and search results This Paper ProteomeXchange - PRIDE: PXD020183 Human Proteome, all canonical reviewed sequences Swiss-Prot, uniprot.org Downloaded 2020-02-10 SARS-CoV-2 Proteome, all Swiss-Prot and TrEMBL sequences Uniprot.org Downloaded 2020-05-03 Imaging and processed data This Paper https://doi.org/10.17632/vhm7zh5ssp.2 Experimental Models: Cell Lines iAT2 Type 2 Pneumocytes CReM, Boston University SPC2-ST-B2 Vero E6 ATCC CRL-1586 Oligonucleotides CCNL_F_1 IDT TGAACGTAATCAAACCCTGGTTCA CCNL-Int_R_3 IDT CCTCTGCACTTCAGCCCATG CCNL1_R_2 IDT TTGCATCTACCTTGCAGCTAGAGC DOCK4_F_1 IDT TCCTCCTCACTGTCCTCACAAGC DOCK4_int_R_3 IDT AAAGCCTAGGCACGCTGCAC DOCK4_R_2 IDT TCACTCGGCTTCACCTAATGTGA FERMT3_F_1 IDT ATCTACCTGCGGTGCCAGGA FERMT3_R_2 IDT TCCAGCGAAAGTTCAAGGCC RBM5_F_1 IDT TAAGCCGTGGTTTCGCCTTC RBM5_R_2 IDT TGGTGATTCAAGGAAAGCACATTG NPR2_F_1 IDT GGCATGGCCTTTCTCCACAA NPR2_R_2 IDT GAACCCCTTGCCAACCACAG (Continued on next page) ll Resource e2 Molecular Cell 80, 1104–1122.e1–e9, December 17, 2020

Techniques: Biomarker Discovery, Western Blot, Infection, Control, RNA Sequencing, Virus, Functional Assay

Figure 5. Time-Resolved Host Cell Responses to SARS-CoV-2 Infection (A) Enrichment map of iAT2 processes and pathways (nodes) altered by infection (red: upregulated/positive; blue: downregulated/negative), grouped and scaled according to shared (edges) and number (size) of components. Quadrants delineate the four-infection time points (1 to 24 hpi); iAT2-specific pathways are outlined in red, while black indicates conserved/generic responses. (B) Comparative analyses of SARS-CoV-2-infected iAT2s (this study), Caco-2 (Bojkova et al., 2020), A549 (Stukalov et al., 2020), and Vero E6 cells (Bouhaddou et al., 2020); positive and negative enrichment of functional annotations based on normalized enrichment scores (NES). (C) Heatmap of differential host pathways/processes common to all four infection studies.

Journal: Molecular cell

Article Title: Actionable Cytopathogenic Host Responses of Human Alveolar Type 2 Cells to SARS-CoV-2.

doi: 10.1016/j.molcel.2020.11.028

Figure Lengend Snippet: Figure 5. Time-Resolved Host Cell Responses to SARS-CoV-2 Infection (A) Enrichment map of iAT2 processes and pathways (nodes) altered by infection (red: upregulated/positive; blue: downregulated/negative), grouped and scaled according to shared (edges) and number (size) of components. Quadrants delineate the four-infection time points (1 to 24 hpi); iAT2-specific pathways are outlined in red, while black indicates conserved/generic responses. (B) Comparative analyses of SARS-CoV-2-infected iAT2s (this study), Caco-2 (Bojkova et al., 2020), A549 (Stukalov et al., 2020), and Vero E6 cells (Bouhaddou et al., 2020); positive and negative enrichment of functional annotations based on normalized enrichment scores (NES). (C) Heatmap of differential host pathways/processes common to all four infection studies.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER danusertib Selleck S1107 dorsomorphin Selleck S7840 ellagic-acid Selleck S1327 emricasan Selleck S7775 FRAX486 Selleck S7807 KN-93 Selleck S7423 levofloxacin Selleck S1940 losmapimod Selleck S7215 NVP-BEZ235 Selleck S1009 PCI-27483 Cayman 21334 PFI-3 Selleck S7315 RK-33 Selleck S8246 Roflumilast Selleck S2131 SB-415286 Selleck S2729 sirolimus Selleck S1039 SRPIN340 Selleck S7270 teriflunomide Selleck S4169 TG-003 Selleck S7320 TIC10 Selleck S7963 tideglusib Selleck S2823 tubercidin Selleck S8095 vandetanib Selleck S1046 VE-822 Selleck S7102 volasertib Selleck S2235 Critical Commercial Assays Pierce Quantitative Colorimetric Peptide Assay Thermo 23275 Deposited Data Raw MS/MS data and search results This Paper ProteomeXchange - PRIDE: PXD020183 Human Proteome, all canonical reviewed sequences Swiss-Prot, uniprot.org Downloaded 2020-02-10 SARS-CoV-2 Proteome, all Swiss-Prot and TrEMBL sequences Uniprot.org Downloaded 2020-05-03 Imaging and processed data This Paper https://doi.org/10.17632/vhm7zh5ssp.2 Experimental Models: Cell Lines iAT2 Type 2 Pneumocytes CReM, Boston University SPC2-ST-B2 Vero E6 ATCC CRL-1586 Oligonucleotides CCNL_F_1 IDT TGAACGTAATCAAACCCTGGTTCA CCNL-Int_R_3 IDT CCTCTGCACTTCAGCCCATG CCNL1_R_2 IDT TTGCATCTACCTTGCAGCTAGAGC DOCK4_F_1 IDT TCCTCCTCACTGTCCTCACAAGC DOCK4_int_R_3 IDT AAAGCCTAGGCACGCTGCAC DOCK4_R_2 IDT TCACTCGGCTTCACCTAATGTGA FERMT3_F_1 IDT ATCTACCTGCGGTGCCAGGA FERMT3_R_2 IDT TCCAGCGAAAGTTCAAGGCC RBM5_F_1 IDT TAAGCCGTGGTTTCGCCTTC RBM5_R_2 IDT TGGTGATTCAAGGAAAGCACATTG NPR2_F_1 IDT GGCATGGCCTTTCTCCACAA NPR2_R_2 IDT GAACCCCTTGCCAACCACAG (Continued on next page) ll Resource e2 Molecular Cell 80, 1104–1122.e1–e9, December 17, 2020

Techniques: Infection, Functional Assay

Figure 7. Depiction of Viral Perturbations to Alveolar Type 2 Cells by SARS-CoV-2 Top: Lung pathobiology caused by SARS-CoV-2, with histologic sections of COVID-19 patient lung biopsies stained with H&E and cytokeratin AE1/AE3 showing diffuse alveolar damage, sloughed pneumocytes, and focal hyalin membrane material (2003 mag). Bottom: Viral-dysregulated iAT2 pathways, processes, proteins, phosphosites, and validated drugs/targets.

Journal: Molecular cell

Article Title: Actionable Cytopathogenic Host Responses of Human Alveolar Type 2 Cells to SARS-CoV-2.

doi: 10.1016/j.molcel.2020.11.028

Figure Lengend Snippet: Figure 7. Depiction of Viral Perturbations to Alveolar Type 2 Cells by SARS-CoV-2 Top: Lung pathobiology caused by SARS-CoV-2, with histologic sections of COVID-19 patient lung biopsies stained with H&E and cytokeratin AE1/AE3 showing diffuse alveolar damage, sloughed pneumocytes, and focal hyalin membrane material (2003 mag). Bottom: Viral-dysregulated iAT2 pathways, processes, proteins, phosphosites, and validated drugs/targets.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER danusertib Selleck S1107 dorsomorphin Selleck S7840 ellagic-acid Selleck S1327 emricasan Selleck S7775 FRAX486 Selleck S7807 KN-93 Selleck S7423 levofloxacin Selleck S1940 losmapimod Selleck S7215 NVP-BEZ235 Selleck S1009 PCI-27483 Cayman 21334 PFI-3 Selleck S7315 RK-33 Selleck S8246 Roflumilast Selleck S2131 SB-415286 Selleck S2729 sirolimus Selleck S1039 SRPIN340 Selleck S7270 teriflunomide Selleck S4169 TG-003 Selleck S7320 TIC10 Selleck S7963 tideglusib Selleck S2823 tubercidin Selleck S8095 vandetanib Selleck S1046 VE-822 Selleck S7102 volasertib Selleck S2235 Critical Commercial Assays Pierce Quantitative Colorimetric Peptide Assay Thermo 23275 Deposited Data Raw MS/MS data and search results This Paper ProteomeXchange - PRIDE: PXD020183 Human Proteome, all canonical reviewed sequences Swiss-Prot, uniprot.org Downloaded 2020-02-10 SARS-CoV-2 Proteome, all Swiss-Prot and TrEMBL sequences Uniprot.org Downloaded 2020-05-03 Imaging and processed data This Paper https://doi.org/10.17632/vhm7zh5ssp.2 Experimental Models: Cell Lines iAT2 Type 2 Pneumocytes CReM, Boston University SPC2-ST-B2 Vero E6 ATCC CRL-1586 Oligonucleotides CCNL_F_1 IDT TGAACGTAATCAAACCCTGGTTCA CCNL-Int_R_3 IDT CCTCTGCACTTCAGCCCATG CCNL1_R_2 IDT TTGCATCTACCTTGCAGCTAGAGC DOCK4_F_1 IDT TCCTCCTCACTGTCCTCACAAGC DOCK4_int_R_3 IDT AAAGCCTAGGCACGCTGCAC DOCK4_R_2 IDT TCACTCGGCTTCACCTAATGTGA FERMT3_F_1 IDT ATCTACCTGCGGTGCCAGGA FERMT3_R_2 IDT TCCAGCGAAAGTTCAAGGCC RBM5_F_1 IDT TAAGCCGTGGTTTCGCCTTC RBM5_R_2 IDT TGGTGATTCAAGGAAAGCACATTG NPR2_F_1 IDT GGCATGGCCTTTCTCCACAA NPR2_R_2 IDT GAACCCCTTGCCAACCACAG (Continued on next page) ll Resource e2 Molecular Cell 80, 1104–1122.e1–e9, December 17, 2020

Techniques: Staining, Membrane

a A volcano plot analysis illustrating the differential expression of DUBs induced by HG/PA in podocytes. ( n = 3 samples for each Ctrl group and HG/PA group; P values were determined by Wald test from DESeq2 software with Benjamini-Hochberg’s correction). b A table shows DUBs with significant differences in MPC5 cells treated with HG/PA. c The mRNA level of Otud5 in HG/PA-induced MPC5 cell lines. ( n = 3 independent experiments; P values were determined by two-tailed unpaired t -test and data are presented as mean ± SD). d Representative western blot of OTUD5 expression in MPC5 cell lines after stimulation with HG/PA for different durations. ( n = 3 independent experiments). e Representative immunofluorescence (IF) images of OTUD5 expression in human renal tissue from normal subjects ( n = 3 samples) and patients with DKD ( n = 3 samples). Scale bar, 50 μm. Representative western blot of OTUD5 expression in renal cortex of T2DM ( f ) mice and T1DM mice ( g ). ( n = 6 samples). Representative western blot of OTUD5 expression in renal cortex of NOD ( h ) mice and db/db mice ( i ). ( n = 6 samples). j , k Representative western blot of OTUD5 expression in primary podocytes of T2DM ( j ) and T1DM ( k ) mice. ( n = 6 samples). l MPC5 cells transfected with Flag-OTUD5 were stimulated with HG/PA for 8 h. Real-time qPCR showed the mRNA levels of Il6 and Tnfα . ( n = 3 independent experiments; P values were determined by one-way ANOVA with Bonferroni’s correction and data are presented as mean ± SD). Representative western blot of Cleaved Caspase3 ( m ) and Nephrin ( n ) expression in OTUD5-overexpression podocytes stimulated by HG/PA for 24 h. ( n = 3 independent experiments).

Journal: Nature Communications

Article Title: Podocyte OTUD5 alleviates diabetic kidney disease through deubiquitinating TAK1 and reducing podocyte inflammation and injury

doi: 10.1038/s41467-024-49854-1

Figure Lengend Snippet: a A volcano plot analysis illustrating the differential expression of DUBs induced by HG/PA in podocytes. ( n = 3 samples for each Ctrl group and HG/PA group; P values were determined by Wald test from DESeq2 software with Benjamini-Hochberg’s correction). b A table shows DUBs with significant differences in MPC5 cells treated with HG/PA. c The mRNA level of Otud5 in HG/PA-induced MPC5 cell lines. ( n = 3 independent experiments; P values were determined by two-tailed unpaired t -test and data are presented as mean ± SD). d Representative western blot of OTUD5 expression in MPC5 cell lines after stimulation with HG/PA for different durations. ( n = 3 independent experiments). e Representative immunofluorescence (IF) images of OTUD5 expression in human renal tissue from normal subjects ( n = 3 samples) and patients with DKD ( n = 3 samples). Scale bar, 50 μm. Representative western blot of OTUD5 expression in renal cortex of T2DM ( f ) mice and T1DM mice ( g ). ( n = 6 samples). Representative western blot of OTUD5 expression in renal cortex of NOD ( h ) mice and db/db mice ( i ). ( n = 6 samples). j , k Representative western blot of OTUD5 expression in primary podocytes of T2DM ( j ) and T1DM ( k ) mice. ( n = 6 samples). l MPC5 cells transfected with Flag-OTUD5 were stimulated with HG/PA for 8 h. Real-time qPCR showed the mRNA levels of Il6 and Tnfα . ( n = 3 independent experiments; P values were determined by one-way ANOVA with Bonferroni’s correction and data are presented as mean ± SD). Representative western blot of Cleaved Caspase3 ( m ) and Nephrin ( n ) expression in OTUD5-overexpression podocytes stimulated by HG/PA for 24 h. ( n = 3 independent experiments).

Article Snippet: Podocyte-specific Otud5 knockout Mice (Nphs1-Cre OTUD5fl/fl mice; OTUD5CKO) were obtained from Gempharmatech Co., Ltd (Jiangsu, China).

Techniques: Expressing, Software, Two Tailed Test, Western Blot, Immunofluorescence, Transfection, Over Expression

a Schematic diagram of the strategy for the generation of podocyte-specific Otud5 knockout mice (OTUD5CKO). b Schematic diagram depicting the procedure of STZ/HFD-induced T2DM mice. c Weekly monitoring of blood glucose levels in mice. Data are presented as mean ± SD. The levels of serum creatinine ( d ), urea nitrogen ( e ), and urine albumin to creatinine ratio ( f ) were analyzed in mice. g , h Representative images of hematoxylin and eosin staining (H&E), periodic acid-Schiff (PAS), and transmission electron microscopy (TEM) in mice. Scale bar: black 20 μm, red 1 μm. ( n = 6 samples). Quantification of glomerular basement membrane (GBM) thickness ( i ) and podocyte foot process numbers ( j , k ) in the glomeruli. l Representative immunofluorescence (IF) images of Nephrin expression in glomeruli from mice. Scale bar, 20 μm. ( n = 6 samples). Real-time qPCR showing mRNA levels of Il6 ( m ) and Tnfα ( n ) in kidney tissues of each group. n = 6 for each group. For d – f , i – k , m , and n , P values were determined by one-way ANOVA with Bonferroni’s correction, and data are presented as mean ± SD.

Journal: Nature Communications

Article Title: Podocyte OTUD5 alleviates diabetic kidney disease through deubiquitinating TAK1 and reducing podocyte inflammation and injury

doi: 10.1038/s41467-024-49854-1

Figure Lengend Snippet: a Schematic diagram of the strategy for the generation of podocyte-specific Otud5 knockout mice (OTUD5CKO). b Schematic diagram depicting the procedure of STZ/HFD-induced T2DM mice. c Weekly monitoring of blood glucose levels in mice. Data are presented as mean ± SD. The levels of serum creatinine ( d ), urea nitrogen ( e ), and urine albumin to creatinine ratio ( f ) were analyzed in mice. g , h Representative images of hematoxylin and eosin staining (H&E), periodic acid-Schiff (PAS), and transmission electron microscopy (TEM) in mice. Scale bar: black 20 μm, red 1 μm. ( n = 6 samples). Quantification of glomerular basement membrane (GBM) thickness ( i ) and podocyte foot process numbers ( j , k ) in the glomeruli. l Representative immunofluorescence (IF) images of Nephrin expression in glomeruli from mice. Scale bar, 20 μm. ( n = 6 samples). Real-time qPCR showing mRNA levels of Il6 ( m ) and Tnfα ( n ) in kidney tissues of each group. n = 6 for each group. For d – f , i – k , m , and n , P values were determined by one-way ANOVA with Bonferroni’s correction, and data are presented as mean ± SD.

Article Snippet: Podocyte-specific Otud5 knockout Mice (Nphs1-Cre OTUD5fl/fl mice; OTUD5CKO) were obtained from Gempharmatech Co., Ltd (Jiangsu, China).

Techniques: Knock-Out, Staining, Transmission Assay, Electron Microscopy, Membrane, Immunofluorescence, Expressing

a Schematic illustration of a quantitative proteomic screen to identify proteins binding to OTUD5. b Mass spectrometry/mass spectrometry (MS/MS) spectrum of the peptide MITTSGPTSEK from TAK1. Co-immunoprecipitation (Co-IP) of OTUD5 and TAK1 in MPC5 cells ( c ) and kidney tissues ( d ). Endogenous OTUD5 was immunoprecipitated. ( n = 3 independent experiments). e Co-IP of OTUD5 in NIH/3T3 co-transfected with Flag-OTUD5 and His-TAK1 plasmids. Exogenous OTUD5 was immunoprecipitated using an anti-Flag antibody. ( n = 3 independent experiments). f His-TAK1 and Flag-OTUD5 were transfected into MPC5 cells with or without HG/PA treatment and then subjected to 10 μM MG132 for 6 h. Ubiquitinated TAK1 was detected by immunoblotting using an anti-ubiquitin antibody. ( n = 3 independent experiments). g His-TAK1, HA-WT Ub, HA-K48 Ub, and HA-K63 Ub were transfected into NIH/3T3 together with Flag-OTUD5 and then subjected to 10 μM MG132 for 6 h. Ubiquitinated TAK1 was detected by immunoblotting using an anti-HA antibody. ( n = 3 independent experiments). h His-TAK1 and HA-K63 Ub were transfected into NIH/3T3 together with Flag-OTUD5 (WT or C224S) and then subjected to 10 μM MG132 for 6 h. Ubiquitinated TAK1 was detected by immunoblotting using an anti-HA antibody. ( n = 3 independent experiments). i Schematic illustration of the construct for mutating the ubiquitinated lysine residue of TAK1. j His-TAK1 (WT, K34R, K158R, K209R or K562R) and HA-WT Ub were transfected into NIH/3T3 together with Flag-OTUD5 and then subjected to 10 μM MG132 for 6 h. Ubiquitinated TAK1 was detected by immunoblotting using an anti-HA antibody. ( n = 3 independent experiments).

Journal: Nature Communications

Article Title: Podocyte OTUD5 alleviates diabetic kidney disease through deubiquitinating TAK1 and reducing podocyte inflammation and injury

doi: 10.1038/s41467-024-49854-1

Figure Lengend Snippet: a Schematic illustration of a quantitative proteomic screen to identify proteins binding to OTUD5. b Mass spectrometry/mass spectrometry (MS/MS) spectrum of the peptide MITTSGPTSEK from TAK1. Co-immunoprecipitation (Co-IP) of OTUD5 and TAK1 in MPC5 cells ( c ) and kidney tissues ( d ). Endogenous OTUD5 was immunoprecipitated. ( n = 3 independent experiments). e Co-IP of OTUD5 in NIH/3T3 co-transfected with Flag-OTUD5 and His-TAK1 plasmids. Exogenous OTUD5 was immunoprecipitated using an anti-Flag antibody. ( n = 3 independent experiments). f His-TAK1 and Flag-OTUD5 were transfected into MPC5 cells with or without HG/PA treatment and then subjected to 10 μM MG132 for 6 h. Ubiquitinated TAK1 was detected by immunoblotting using an anti-ubiquitin antibody. ( n = 3 independent experiments). g His-TAK1, HA-WT Ub, HA-K48 Ub, and HA-K63 Ub were transfected into NIH/3T3 together with Flag-OTUD5 and then subjected to 10 μM MG132 for 6 h. Ubiquitinated TAK1 was detected by immunoblotting using an anti-HA antibody. ( n = 3 independent experiments). h His-TAK1 and HA-K63 Ub were transfected into NIH/3T3 together with Flag-OTUD5 (WT or C224S) and then subjected to 10 μM MG132 for 6 h. Ubiquitinated TAK1 was detected by immunoblotting using an anti-HA antibody. ( n = 3 independent experiments). i Schematic illustration of the construct for mutating the ubiquitinated lysine residue of TAK1. j His-TAK1 (WT, K34R, K158R, K209R or K562R) and HA-WT Ub were transfected into NIH/3T3 together with Flag-OTUD5 and then subjected to 10 μM MG132 for 6 h. Ubiquitinated TAK1 was detected by immunoblotting using an anti-HA antibody. ( n = 3 independent experiments).

Article Snippet: Podocyte-specific Otud5 knockout Mice (Nphs1-Cre OTUD5fl/fl mice; OTUD5CKO) were obtained from Gempharmatech Co., Ltd (Jiangsu, China).

Techniques: Binding Assay, Mass Spectrometry, Tandem Mass Spectroscopy, Immunoprecipitation, Co-Immunoprecipitation Assay, Transfection, Western Blot, Construct, Residue

MPC5 cells transfected with Flag-OTUD5 ( a ) or si-OTUD5 ( b ) were stimulated with HG/PA for 30 min. Representative western blot analysis of P-TAK1. ( n = 3 independent experiments). c , d Representative western blot analysis of P-TAK1 in kidney tissues of each group. ( n = 6 samples). MPC5 cells transfected with Flag-OTUD5 ( e ) or si-OTUD5 ( f ) were stimulated with HG/PA for 30 min. Representative western blot analysis of phosphorylated and total protein levels of ERK, P38, and JNK. ( n = 3 independent experiments). MPC5 cells transfected with si-OTUD5 were pretreated with 10 μM Takinib (TAK1 inhibitor) for 1 h before exposure to HG/PA. g Levels of P-TAK1, P-ERK, P-P38, and P-JNK were detected by western blot. h Real-time qPCR showing mRNA levels of Il6 and Tnfα . ( n = 3 independent experiments; P values were determined by one-way ANOVA with Bonferroni’s correction and data are presented as mean ± SD). i His-TAK1 was transfected into NIH/3T3 with or without Flag-OTUD5 (WT or C224A). Co-IP was performed with an anti-His antibody, followed by a western blot of TAK1 and TAB2. ( n = 3 independent experiments). j MPC5 cells transfected with Flag-OTUD5 (WT or C224A) were stimulated with HG/PA for 30 min. Representative western blot analysis of phosphorylated and total protein levels of TAK1, ERK, P38, and JNK. ( n = 3 independent experiments). k His-TAK1(WT or K158R) was transfected into NIH/3T3 with or without Flag-OTUD5. Co-IP was performed with an anti-His antibody, followed by a western blot of TAK1 and TAB2. ( n = 3 independent experiments). l His-TAK1 (WT or K158R) and Flag-OTUD5 were transfected into MPC5 cells for 24 h and then stimulated by HG/PA for 30 min. Representative western blot analysis of phosphorylated and total protein levels of TAK1, ERK, P38, and JNK. ( n = 3 independent experiments).

Journal: Nature Communications

Article Title: Podocyte OTUD5 alleviates diabetic kidney disease through deubiquitinating TAK1 and reducing podocyte inflammation and injury

doi: 10.1038/s41467-024-49854-1

Figure Lengend Snippet: MPC5 cells transfected with Flag-OTUD5 ( a ) or si-OTUD5 ( b ) were stimulated with HG/PA for 30 min. Representative western blot analysis of P-TAK1. ( n = 3 independent experiments). c , d Representative western blot analysis of P-TAK1 in kidney tissues of each group. ( n = 6 samples). MPC5 cells transfected with Flag-OTUD5 ( e ) or si-OTUD5 ( f ) were stimulated with HG/PA for 30 min. Representative western blot analysis of phosphorylated and total protein levels of ERK, P38, and JNK. ( n = 3 independent experiments). MPC5 cells transfected with si-OTUD5 were pretreated with 10 μM Takinib (TAK1 inhibitor) for 1 h before exposure to HG/PA. g Levels of P-TAK1, P-ERK, P-P38, and P-JNK were detected by western blot. h Real-time qPCR showing mRNA levels of Il6 and Tnfα . ( n = 3 independent experiments; P values were determined by one-way ANOVA with Bonferroni’s correction and data are presented as mean ± SD). i His-TAK1 was transfected into NIH/3T3 with or without Flag-OTUD5 (WT or C224A). Co-IP was performed with an anti-His antibody, followed by a western blot of TAK1 and TAB2. ( n = 3 independent experiments). j MPC5 cells transfected with Flag-OTUD5 (WT or C224A) were stimulated with HG/PA for 30 min. Representative western blot analysis of phosphorylated and total protein levels of TAK1, ERK, P38, and JNK. ( n = 3 independent experiments). k His-TAK1(WT or K158R) was transfected into NIH/3T3 with or without Flag-OTUD5. Co-IP was performed with an anti-His antibody, followed by a western blot of TAK1 and TAB2. ( n = 3 independent experiments). l His-TAK1 (WT or K158R) and Flag-OTUD5 were transfected into MPC5 cells for 24 h and then stimulated by HG/PA for 30 min. Representative western blot analysis of phosphorylated and total protein levels of TAK1, ERK, P38, and JNK. ( n = 3 independent experiments).

Article Snippet: Podocyte-specific Otud5 knockout Mice (Nphs1-Cre OTUD5fl/fl mice; OTUD5CKO) were obtained from Gempharmatech Co., Ltd (Jiangsu, China).

Techniques: Transfection, Western Blot, Co-Immunoprecipitation Assay

a A schematic diagram illustrating the procedure of T2DM-induced OTUD5CKO and Otud5 fl/fl mice, with or without Takinib administration. b Weekly measurements of blood glucose levels of the mice in the indicated groups. Data are presented as mean ± SD. c Representative western blot images showing phosphorylated and total protein levels of TAK1, ERK, P38, and JNK in the kidneys of indicated groups. ( n = 6 samples). Serum creatinine ( d ), urea nitrogen ( e ), and urine albumin to creatinine ratio ( f ) levels of the mice in the indicated groups. g Representative H&E and PAS staining images of kidney sections. Scale bar: 20 μm. ( n = 6 samples). h – k Representative TEM images of kidney sections and corresponding quantitative analysis. Scale bar: 1 μm. l Representative IF images of Nephrin expression in the glomeruli of the indicated groups. Scale bar, 20 μm. n = 6 for each group. For d – f , i , j , and k , P values were determined by one-way ANOVA with Bonferroni’s correction, and data are presented as mean ± SD.

Journal: Nature Communications

Article Title: Podocyte OTUD5 alleviates diabetic kidney disease through deubiquitinating TAK1 and reducing podocyte inflammation and injury

doi: 10.1038/s41467-024-49854-1

Figure Lengend Snippet: a A schematic diagram illustrating the procedure of T2DM-induced OTUD5CKO and Otud5 fl/fl mice, with or without Takinib administration. b Weekly measurements of blood glucose levels of the mice in the indicated groups. Data are presented as mean ± SD. c Representative western blot images showing phosphorylated and total protein levels of TAK1, ERK, P38, and JNK in the kidneys of indicated groups. ( n = 6 samples). Serum creatinine ( d ), urea nitrogen ( e ), and urine albumin to creatinine ratio ( f ) levels of the mice in the indicated groups. g Representative H&E and PAS staining images of kidney sections. Scale bar: 20 μm. ( n = 6 samples). h – k Representative TEM images of kidney sections and corresponding quantitative analysis. Scale bar: 1 μm. l Representative IF images of Nephrin expression in the glomeruli of the indicated groups. Scale bar, 20 μm. n = 6 for each group. For d – f , i , j , and k , P values were determined by one-way ANOVA with Bonferroni’s correction, and data are presented as mean ± SD.

Article Snippet: Podocyte-specific Otud5 knockout Mice (Nphs1-Cre OTUD5fl/fl mice; OTUD5CKO) were obtained from Gempharmatech Co., Ltd (Jiangsu, China).

Techniques: Western Blot, Staining, Expressing

a A schematic diagram illustrating the procedure of T2DM-induced Otud5 fl/fl mice injected with AAV-EV or AAV-OTUD5. b The levels of blood glucose. Data are presented as mean ± SD. c Ubiquitinated TAK1 was detected by immunoblotting using anti-ubiquitin antibodies in the kidneys of indicated groups. ( n = 6 samples). d Representative western blot images showing phosphorylated and total protein levels of TAK1 in the kidneys of indicated groups. ( n = 6 samples). The levels of serum creatinine ( e ), urea nitrogen ( f ), and urine albumin to creatinine ratio ( g ). h Representative H&E and PAS staining of kidney sections. ( n =6 samples). i – l Representative TEM images of kidney sections and corresponding quantitative analysis. Scale bar: 1 μm. m Representative IF images of Nephrin expression. Scale bar, 20 μm. ( n = 6 samples). n = 6 for each group. For e – g and j – l , P values were determined by a two-tailed unpaired t -test, and data are presented as mean ± SD.

Journal: Nature Communications

Article Title: Podocyte OTUD5 alleviates diabetic kidney disease through deubiquitinating TAK1 and reducing podocyte inflammation and injury

doi: 10.1038/s41467-024-49854-1

Figure Lengend Snippet: a A schematic diagram illustrating the procedure of T2DM-induced Otud5 fl/fl mice injected with AAV-EV or AAV-OTUD5. b The levels of blood glucose. Data are presented as mean ± SD. c Ubiquitinated TAK1 was detected by immunoblotting using anti-ubiquitin antibodies in the kidneys of indicated groups. ( n = 6 samples). d Representative western blot images showing phosphorylated and total protein levels of TAK1 in the kidneys of indicated groups. ( n = 6 samples). The levels of serum creatinine ( e ), urea nitrogen ( f ), and urine albumin to creatinine ratio ( g ). h Representative H&E and PAS staining of kidney sections. ( n =6 samples). i – l Representative TEM images of kidney sections and corresponding quantitative analysis. Scale bar: 1 μm. m Representative IF images of Nephrin expression. Scale bar, 20 μm. ( n = 6 samples). n = 6 for each group. For e – g and j – l , P values were determined by a two-tailed unpaired t -test, and data are presented as mean ± SD.

Article Snippet: Podocyte-specific Otud5 knockout Mice (Nphs1-Cre OTUD5fl/fl mice; OTUD5CKO) were obtained from Gempharmatech Co., Ltd (Jiangsu, China).

Techniques: Injection, Western Blot, Staining, Expressing, Two Tailed Test